Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR
Victor M Corman1, Olfert Landt2, Marco Kaiser3, Richard Molenkamp4, Adam Meijer5, Daniel KW Chu6, Tobias Bleicker1, Sebastian Brünink1, Julia Schneider1, Marie Luisa Schmidt1, Daphne GJC Mulders4, Bart L Haagmans4, Bas van der Veer5, Sharon van den Brink5, Lisa Wijsman5, Gabriel Goderski5, Jean-Louis Romette7, Joanna Ellis8, Maria Zambon8, Malik Peiris6, Herman Goossens9, Chantal Reusken5, Marion PG Koopmans4, Christian Drosten1
- Charité – Universitätsmedizin Berlin Institute of Virology, Berlin, Germany and German Centre for Infection Research (DZIF), Berlin, Germany
- Tib-Molbiol, Berlin, Germany
- GenExpress GmbH, Berlin, Germany*
- Department of Viroscience, Erasmus MC, Rotterdam, the Netherlands
- National Institute for Public Health and the Environment (RIVM), Bilthoven, the Netherlands
- University of Hong Kong, Hong Kong, China
- Universite d Aix-Marseille, Marseille, France
- Public Health England, London, United Kingdom
- Department of Medical Microbiology, Vaccine and Infectious Diseases Institute, University of Antwerp, Antwerp, Belgium
Correspondence: Christian Drosten (christian.drosten@charite.de)
Citation style for this article:
Corman Victor M, Landt Olfert, Kaiser Marco, Molenkamp Richard, Meijer Adam, Chu Daniel KW, Bleicker Tobias, Brünink Sebastian, Schneider Julia, Schmidt Marie Luisa, Mulders Daphne GJC, Haagmans Bart L, van der Veer Bas, van den Brink Sharon, Wijsman Lisa, Goderski Gabriel, Romette Jean-Louis, Ellis Joanna, Zambon Maria, Peiris Malik, Goossens Herman, Reusken Chantal, Koopmans Marion PG, Drosten Christian. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 2020;25(3):pii=2000045. https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045
Background: The ongoing outbreak of the recently emerged novel coronavirus (2019-nCoV) poses a chal- lenge for public health laboratories as virus isolates are unavailable while there is growing evidence that the outbreak is more widespread than initially thought, and international spread through travellers does already occur. Aim: We aimed to develop and deploy robust diagnostic methodology for use in public health laboratory settings without having virus material avail- able. Methods: Here we present a validated diagnostic workflow for 2019-nCoV, its design relying on close genetic relatedness of 2019-nCoV with SARS coronavi- rus, making use of synthetic nucleic acid technology. Results: The workflow reliably detects 2019-nCoV, and further discriminates 2019-nCoV from SARS-CoV. Through coordination between academic and public laboratories, we confirmed assay exclusivity based on 297 original clinical specimens containing a full spectrum of human respiratory viruses. Control mate- rial is made available through European Virus Archive – Global (EVAg), a European Union infrastructure pro- ject. Conclusion: The present study demonstrates the enormous response capacity achieved through coordi- nation of academic and public laboratories in national and European research networks.
Introduction
According to the World Health Organization (WHO), the WHO China Country Office was informed of cases of pneumonia of unknown aetiology in Wuhan City, Hubei Province, on 31 December 2019 [1]. A novel coronavirus currently termed 2019-nCoV was officially announced
Article submitted on 21 Jan 2020 / accepted on 22 Jan 2020 / published on 23 Jan 2020
as the causative agent by Chinese authorities on 7 January. A viral genome sequence was released for immediate public health support via the com- munity online resource virological.org on 10 January (Wuhan-Hu-1, GenBank accession number MN908947 [2]), followed by four other genomes deposited on 12 January in the viral sequence database curated by the Global Initiative on Sharing All Influenza Data (GISAID). The genome sequences suggest presence of a virus closely related to the members of a viral species termed severe acute respiratory syndrome (SARS)-related CoV, a species defined by the agent of the 2002/03 outbreak of SARS in humans [3,4]. The species also comprises a large number of viruses mostly detected in rhinolophid bats in Asia and Europe.
As at 20 January 2020*, 282 laboratory-confirmed human cases have been notified to WHO [5]. Confirmed cases in travellers from Wuhan were announced on 13 and 17 January in Thailand as well as on 15 January in Japan and 19 January in Korea. The extent of human- to-human transmission of 2019-nCoV is unclear at the time of writing of this report but there is evidence of some human-to-human transmission.
Among the foremost priorities to facilitate public health interventions is reliable laboratory diagnosis. In acute respiratory infection, RT-PCR is routinely used to detect causative viruses from respiratory secretions. We have previously demonstrated the feasibility of introducing robust detection technology based on real-time RT-PCR in public health laboratories during international
www.eurosurveillance.org
23
Table 1
Primers and probes, real-time RT-PCR for 2019 novel coronavirus
Assay/use |
Oligonucleotide |
Sequencea |
Concentrationb |
RdRP gene
E gene
N gene
RdRp_SARSr-F RdRp_SARSr-P2
RdRP_SARSr-P1 RdRp_SARSr-R
E_Sarbeco_F E_Sarbeco_P1 E_Sarbeco_R
N_Sarbeco_F N_Sarbeco_P N_Sarbeco_R
GTGARATGGTCATGTGTGGCGG FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ
FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ
CARATGTTAAASACACTATTAGCATA
ACAGGTACGTTAATAGTTAATAGCGT FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ ATATTGCAGCAGTACGCACACA CACATTGGCACCCGCAATC FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ GAGGAACGAGAAGAGGCTTG
Use 600 nM per reaction
Specific for 2019-nCoV, will not detect SARS-CoV.
Use 100 nM per reaction and mix with P1
Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.
Use 100 nM per reaction and mix with P2 Use 800 nM per reaction
Use 400 nm per reaction
Use 200 nm per reaction
Use 400 nm per reaction
Use 600 nm per reaction
Use 200 nm per reaction
Use 800 nm per reaction
a W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.
b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5μL of a 10μM primer stock solution per 25μL total reaction volume yields a final concentration of 600 nM as indicated in the table.
health emergencies by coordination between public and academic laboratories [6-12]. In all of these situ- ations, virus isolates were available as the primary substrate for establishing and controlling assays and assay performance.
In the present case of 2019-nCoV, virus isolates or samples from infected patients have so far not become available to the international public health community. We report here on the establishment and validation of a diagnostic workflow for 2019-nCoV screening and specific confirmation, designed in absence of available virus isolates or original patient specimens. Design and validation were enabled by the close genetic relat- edness to the 2003 SARS-CoV, and aided by the use of synthetic nucleic acid technology.
Methods
Clinical samples and coronavirus cell culture supernatants for initial assay evaluation
Cell culture supernatants containing typed coronavi- ruses and other respiratory viruses were provided by Charité and University of Hong Kong research labo- ratories. Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S ́Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10]. Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong. Samples from all collections
comprised sputum as well as nose and throat swabs with or without viral transport medium.
Faecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/ BGR/2008; GU190221 Betacoronavirus Bat coronavi- rus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008. All synthetic RNA used in this study was photometri- cally quantified.
RNA extraction
RNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).
Real-time reverse-transcription PCR
A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/ Taq mixture from the kit, 0.4 μL of a 50 mM magne- sium sulphate solution (Invitrogen), and 1 μg of nona- cetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentra- tions are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin,
24
www.eurosurveillance.org
Figure 1
Relative positions of amplicon targets on the SARS coronavirus and the 2019 novel coronavirus genome
Orf1a Orf1ab
S
E M N
MN908947 W uhan-Hu-1 NC_004718 SARS-CoV
E: envelope protein gene; M: membrane protein gene; N: nucleocapsid protein gene; ORF: open reading frame; RdRp: RNA-dependent RNA polymerase gene; S: spike protein gene.
Numbers below amplicons are genome positions according to SARS-CoV, GenBank NC_004718.
Germany). Thermal cycling was performed at 55°C for 10 min for reverse transcription, followed by 95°C for 3 min and then 45 cycles of 95°C for 15 s, 58°C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).
Protocol options and application notes
Laboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions. The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.
The intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019- nCoV RNA.
For a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirma- tory testing with the RdRp gene assay. Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control. Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.
Ethical statement
The internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners.
Results
Before public release of virus sequences from cases of 2019-nCoV, we relied on social media reports announc- ing detection of a SARS-like virus. We thus assumed that a SARS-related CoV is involved in the outbreak. We downloaded all complete and partial (if>400 nt) SARS-related virus sequences available in GenBank by 1 January 2020. The list (n=729 entries) was manually checked and artificial sequences (laboratory-derived,
synthetic, etc), as well as sequence duplicates were removed, resulting in a final list of 375 sequences. These sequences were aligned and the alignment was used for assay design (Supplementary Figure S1). Upon release of the first 2019-nCoV sequence at virological. org, three assays were selected based on how well they matched to the 2019-nCoV genome (Figure 1). The alignment was complemented by additional sequences released independently on GISAID (https://www. gisaid.org), confirming the good matching of selected primers to all sequences. Alignments of primer bind- ing domains with 2019-nCoV, SARS-CoV as well as selected bat-associated SARS-related CoV are shown in Figure 2.
Assay sensitivity based on SARS coronavirus virions
To obtain a preliminary assessment of analytical sen- sitivity, we used purified cell culture supernatant containing SARS-CoV strain Frankfurt-1 virions grown on Vero cells. The supernatant was ultrafiltered and thereby concentrated from a ca 20-fold volume of cell culture supernatant. The concentration step simulta- neously reduces the relative concentration of back- ground nucleic acids such as not virion-packaged viral RNA. The virion preparation was quantified by real- time RT-PCR using a specific in vitro-transcribed RNA quantification standard as described in Drosten et al. [8]. All assays were subjected to replicate testing in order to determine stochastic detection frequencies at each assay’s sensitivity end point (Figure 3A and B). All assays were highly sensitive, with best results obtained for the E gene and RdRp gene assays (5.2 and 3.8 copies per reaction at 95% detection probability, respectively). These two assays were chosen for further evaluation. One of the laboratories participating in the external evaluation used other basic RT-PCR reagents (TaqMan Fast Virus 1-Step Master Mix) and repeated the sensitivity study, with equivalent results (E gene: 3.2 RNA copies/reaction (95% CI: 2.2–6.8); RdRP: 3.7 RNA copies/reaction (95% CI: 2.8–8.0). Of note, the N gene assay also performed well but was not subjected
www.eurosurveillance.org
25
15,361–15,460
RdRp E N
26,141–26,253
28,555–28,682
Figure 2
Partial alignments of oligonucleotide binding regions, SARS-related coronaviruses (n = 9)
A. RdRp gene
WH-Human_1|China|2019-Dec
BetaCoV/Wuhan/IPBCAMS-WH-01/2019|EPI_ISL_402123 BetaCoV/Wuhan/IVDC-HB-01/2019|EPI_ISL_402119 BetaCoV/Wuhan/IVDC-HB-04/2020|EPI_ISL_402120 BetaCoV/Wuhan/IVDC-HB-05/2019|EPI_ISL_402121 BetaCoV/Wuhan/WIV04/2019|EPI_ISL_402124 MG772933 Bat SARS-related CoV (bat-SL-CoVZC45) NC_004718 Human SARS-related CoV (e.g. Frankfurt-1) NC_014470 Bat SARS-related CoV (BM48-31/BGR/2008)
B. E gene
WH-Human_1|China|2019-Dec
BetaCoV/Wuhan/IPBCAMS-WH-01/2019|EPI_ISL_402123 BetaCoV/Wuhan/IVDC-HB-01/2019|EPI_ISL_402119 BetaCoV/Wuhan/IVDC-HB-04/2020|EPI_ISL_402120 BetaCoV/Wuhan/IVDC-HB-05/2019|EPI_ISL_402121 BetaCoV/Wuhan/WIV04/2019|EPI_ISL_402124 MG772933 Bat SARS-related CoV (bat-SL-CoVZC45) NC_004718 Human SARS-related CoV (e.g. Frankfurt-1) NC_014470 Bat SARS-related CoV (BM48-31/BGR/2008)
C. N gene
WH-Human_1|China|2019-Dec
BetaCoV/Wuhan/IPBCAMS-WH-01/2019|EPI_ISL_402123 BetaCoV/Wuhan/IVDC-HB-01/2019|EPI_ISL_402119 BetaCoV/Wuhan/IVDC-HB-04/2020|EPI_ISL_402120 BetaCoV/Wuhan/IVDC-HB-05/2019|EPI_ISL_402121 BetaCoV/Wuhan/WIV04/2019|EPI_ISL_402124 MG772933 Bat SARS-related CoV (bat-SL-CoVZC45) NC_004718 Human SARS-related CoV (e.g. Frankfurt-1) NC_014470 Bat SARS-related CoV (BM48-31/BGR/2008)
RdRp_SARSr-F
E_Sarbeco_F
N_Sarbeco_F
P1: P2:
RdRp_SARSr- RdRP_SARSr-P2
E_Sarbeco_P1
N_Sarbeco_P
RdRp_SARSr-R
E_Sarbeco_R
N_Sarbeco_R
The panels show six available sequences of 2019-nCoV, aligned to the corresponding partial sequences of SARS-CoV strain Frankfurt 1, which can be used as a positive control for all three RT-PCR assays. The alignment also contains a closely related bat virus (Bat SARS-related CoV isolate bat-SL-CoVZC45, GenBank accession number MG772933) as well as the most distant member within the SARS-related bat CoV clade, detected in Bulgaria (GenBank accession number NC_014470). Dots represent identical nucleotides compared with the WH_Human_1 sequence. Nucleotide substitutions are specified. Blue arrows: oligonucleotides as specified in Table 1. More comprehensive alignments can be found in the Supplement.
to intensive further validation because it was slightly less sensitive (Supplementary Figure S2)
Sensitivity based on in vitro-transcribed RNA identical to 2019 novel coronavirus target sequences
Although both assays detected 2019-nCoV without polymorphisms at oligonucleotide binding sites (Figure 2), we additionally generated in vitro-transcribed RNA standards that exactly matched the sequence of 2019- nCoV for absolute quantification and studying the limit of detection (LOD). Replicate reactions were done at concentrations around the detection end point deter- mined in preliminary dilution experiments. The result- ing LOD from replicate tests was 3.9 copies per reaction for the E gene assay and 3.6 copies per reaction for the RdRp assay (Figure 3C and D). These figures were close to the 95% hit rate of 2.9 copies per reaction, according to the Poisson distribution, expected when one RNA molecule is detected.
Discrimination of 2019 novel coronavirus from SARS coronavirus by RdRp assay
Following the rationale that SARS-CoV RNA can be used as a positive control for the entire laboratory pro- cedure, thus obviating the need to handle 2019-nCoV RNA, we formulated the RdRp assay so that it contains two probes: a broad-range probe reacting with SARS- CoV and 2019-nCoV and an additional probe that reacts
only with 2019-nCoV. By limiting dilution experiments, we confirmed that both probes, whether used indi- vidually or in combination, provided the same LOD for each target virus. The specific probe RdRP_SARSr-P2 detected only the 2019-nCoV RNA transcript but not the SARS-CoV RNA.
Detection range for SARS-related coronaviruses from bats
At present, the potential exposure to a common envi- ronmental source in early reported cases implicates the possibility of independent zoonotic infections with increased sequence variability [5]. To show that the assays can detect other bat-associated SARS-related viruses, we used the E gene assay to test six bat- derived faecal samples available from Drexler et al. [13] und Muth et al. [14]. These virus-positive samples stemmed from European rhinolophid bats. Detection of these phylogenetic outliers within the SARS-related CoV clade suggests that all Asian viruses are likely to be detected. This would, theoretically, ensure broad sensitivity even in case of multiple independent acqui- sitions of variant viruses from an animal reservoir.
Specificity testing
Chemical stability
To exclude non-specific reactivity of oligonucleo- tides among each other, causing artificial fluorescent
26
www.eurosurveillance.org
Figure 3
Determination of limits of detection based on SARS coronavirus genomic RNA and 2019 novel coronavirus-specific in vitro transcribed RNA
A. E gene assay vs SARS-CoV: 5.2 c/r (95% CI: 3.7–9.6)
1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
B. RdRp gene assay vs SARS-CoV: 3.8 c/r (95% CI: 2.7–7.6)
0.0 5.0 10.0
Copies per reaction
1 0. 9 0. 8 0. 7 0. 6 0. 5 0. 4 0. 3 0. 2 0. 1 0
20. 0 0.0
5.0 10.0 15.0 Copies per reaction
20. 0
C. E gene assay vs 2019-nCoV IVT RNA: 3.9 c/r (95% CI: 2.8–9.8)
D. RdRp assay vs 2019-nCoV IVT RNA: 3.6 c/r (95%: 2.7–11.2)
1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
0.0 5.0 10.0 15.0 Copies per reaction
0. 0. 0. 0. 0. 0. 0. 0. 0.
1 9 8 7 6 5 4 3 2 1
0
15.0
CI: confidence intervals; c/r: copies per reaction; IVT: in vitro-transcribed RNA.
20. 0
0.0
5.0 10.0 15.0 Copies per reaction
20. 0
A: E gene assay, evaluated with SARS-CoV genomic RNA. B: RdRp gene assay evaluated with SARS-CoV genomic RNA. C: E-gene assay, evaluated with 2019-nCoV-specific in vitro-transcribed RNA standard. D: RdRp gene assay evaluated with 2019-nCoV-specific in vitro- transcribed RNA standard.
The x-axis shows input RNA copies per reaction. The y-axis shows positive results in all parallel reactions performed, squares are experimental data points resulting from replicate testing of given concentrations (x-axis) in parallels assays (eight replicate reactions per point).
Technical limits of detection are given in the panels headings. The inner line is a probit curve (dose-response rule). The outer dotted lines are 95% CI.
www.eurosurveillance.org 27
Fraction positive Fraction positive
Fraction positive
Fraction positiv e
Table 2
Tests of known respiratory viruses and bacteria in clinical samples and cell culture preparations for cross-reactivity in 2019 novel coronavirus E and RdRp gene assays (n = 310)
HCoV-HKU1 14 1c
standards designed for absolute quantification of viral load. Additional undiluted (but not quantified) cell cul- ture supernatants were tested as summarised in Table 2. These were additionally mixed into negative human sputum samples. None of the tested viruses or virus preparations showed reactivity with any assay.
Exclusivity of 2019 novel coronavirus based on clinical samples pre-tested positive for other respiratory viruses Using the E and RdRp gene assays, we tested a total of 297 clinical samples from patients with respiratory disease from the biobanks of five laboratories that provide diagnostic services (one in Germany, two in the Netherlands, one in Hong Kong, one in the UK). We selected 198 samples from three university medical centres where patients from general and intensive care wards as well as mainly paediatric outpatient depart- ments are seen (Germany, the Netherlands, Hong Kong). The remaining samples were contributed by national public health services performing surveillance studies (RIVM, PHE), with samples mainly submitted by practitioners. The samples contained the broadest range of respiratory agents possible and reflected the general spectrum of virus concentrations encountered in diagnostic laboratories in these countries (Table 2). In total, this testing yielded no false positive outcomes. In four individual test reactions, weak initial reactivity was seen but they were negative upon retesting with the same assay. These signals were not associated with any particular virus, and for each virus with which initial positive reactivity occurred, there were other samples that contained the same virus at a higher con- centration but did not test positive. Given the results from the extensive technical qualification described above, it was concluded that this initial reactivity was not due to chemical instability of real-time PCR probes but most probably to handling issues caused by the rapid introduction of new diagnostic tests and controls during this evaluation study.
Discussion
The present report describes the establishment of a diagnostic workflow for detection of an emerging virus in the absence of physical sources of viral genomic nucleic acid. Effective assay design was enabled by the willingness of scientists from China to share genome information before formal publication, as well as the availability of broad sequence knowledge from ca 15 years of investigation of SARS-related viruses in animal reservoirs. The relative ease with which assays could be designed for this virus, in contrast to SARS-CoV in 2003, proves the huge collective value of descriptive studies of disease ecology and viral genome diversity [8,15-17].
Real-time RT-PCR is widely deployed in diagnostic virol- ogy. In the case of a public health emergency, profi- cient diagnostic laboratories can rely on this robust technology to establish new diagnostic tests within their routine services before pre-formulated assays become available. In addition to information on
Clinical samples with known viruses |
Clinical samplesa |
Virus isolatesb |
HCoV-OC43 16
HCoV-NL63 14
2d
1e
HCoV-229E 18 2f
MERS-CoV 5 1g
Influenza A(H1N1)pdm09 17
Influenza A(H3N2) 16
Influenza A (untyped) 11
Influenza A(H5N1) 1
Influenza A(H7N9) 0
Influenza B (Victoria or
Yamagata) 31
Rhinovirus/enterovirus 31
Respiratory syncytial virus (A/B) 33
Parainfluenza 1 virus 12
Parainfluenza 2 virus 11
Parainfluenza 3 virus 14
Parainfluenza 4 virus 11
1
1
NA
1
1
1
NA
NA
NA
NA
NA
NA
Human metapneumovirus 16 NA
Adenovirus 13 1
Human bocavirus 6
Legionella spp. 3
NA
NA
Mycoplasma spp. 4 NA
Total clinical samples 297 NA
a For samples with multiple viruses detected, the virus with highest concentration is listed, as indicated by real-time PCR Ct value.
b Directly quantified or spiked in human negative-testing sputum.
c 1 × 105 RNA copies/mL, determined by specific real-time RT-PCR. Isolated from human airway epithelial culture.
d 1 × 1010 RNA copies/mL, determined by specific real-time RT-PCR of one isolate. The other isolate was not quantified but spiked in human negative-testing sputum.
e 4 × 109 RNA copies/mL, determined by specific real-time RT-PCR.
f 3 × 109 RNA copies/mL, determined by specific real-time RT-PCR of one isolate. The other isolate was not quantified spiked in human negative-testing sputum.
g 1 × 108 RNA copies/mL, determined by specific real-time RT-PCR.
signals, all assays were tested 120 times in parallel with water and no other nucleic acid except the pro- vided oligonucleotides. In none of these reactions was any positive signal detected.
Cross-reactivity with other coronaviruses
Cell culture supernatants containing all endemic human coronaviruses (HCoV)229E, NL63, OC43 and HKU1 as well as MERS-CoV were tested in duplicate in all three assays (Table 2). For the non-cultivable HCoV-HKU1, supernatant from human airway culture was used. Viral RNA concentration in all samples was determined by specific real-time RT-PCRs and in vitro-transcribed RNA
28
www.eurosurveillance.org
reagents, oligonucleotides and positive controls, lab- oratories working under quality control programmes need to rely on documentation of technical qualifi- cation of the assay formulation as well as data from external clinical evaluation tests. The provision of con- trol RNA templates has been effectively implemented by the EVAg project that provides virus-related rea- gents from academic research collections [18]. SARS- CoV RNA was retrievable from EVAg before the present outbreak; specific products such as RNA transcripts for the here-described assays were first retrievable from the EVAg online catalogue on 14 January 2020 (https://www.european-virus-archive.com). Technical qualification data based on cell culture materials and synthetic constructs, as well as results from exclusiv- ity testing on 75 clinical samples, were included in the first version of the diagnostic protocol provided to the WHO on 13 January 2020. Based on efficient collabo- ration in an informal network of laboratories, these data were augmented within 1 week comprise testing results based on a wide range of respiratory pathogens in clinical samples from natural infections. Comparable evaluation studies during regulatory qualification of in vitro diagnostic assays can take months for organisa- tion, legal implementation and logistics and typically come after the peak of an outbreak has waned. The speed and effectiveness of the present deployment and evaluation effort were enabled by national and European research networks established in response to international health crises in recent years, demon- strating the enormous response capacity that can be released through coordinated action of academic and public laboratories [18-22]. This laboratory capacity not only supports immediate public health interventions but enables sites to enrol patients during rapid clinical research responses.
*Author’s correction
The sentence As at 20 January 2020, 282 laboratory-con- firmed human cases have been notified to WHO was origi- nally published with a wrong date (As at 20 January 2019…). This mistake was corrected on 8 April 2020.
On 29 July 2020 the correct affiliation of Marco Kaiser was added and the remaining affiliations were renumbered.
**Addendum
The Conflict of interest section was updated on 29 July 2020.
Acknowledgements
This work was funded by European Union DG Research through projects Prepare (GA602525), Compare (GA643476), and EVAg (GA653316); by European Union DG SANCO through EVD-LabNet, as well as by the German Ministry of Research through projects RAPID (01KI1723A) and DZIF (301-4-7-01.703).
We gratefully acknowledge the authors, the originating and submitting laboratories for their sequence and metadata shared through GISAID, on which this research is based.
All authors of data may be contacted directly via www.gi- said.org: National Institute for Viral Disease Control and Prevention, China CDC (Wenjie Tan, Xiang Zhao, Wenling Wang, Xuejun Ma, Yongzhong Jiang, Roujian Lu, Ji Wang, Weimin Zhou, Peihua Niu, Peipei Liu,Faxian Zhan, Weifeng Shi, Baoying Huang, Jun Liu, Li Zhao, Yao Meng, Xiaozhou He, Fei Ye, Na Zhu, Yang Li, Jing Chen, Wenbo Xu, George F. Gao, Guizhen Wu); Wuhan Institute of Virology, Chinese Academy of Sciences (Peng Zhou, Xing-Lou Yang, Ding-Yu Zhang, Lei Zhang, Yan Zhu, Hao-Rui Si, Zhengli Shi); Institute of Pathogen Biology, Chinese Academy of Medical Sciences and Peking Union Medical College (Lili Ren, Jianwei Wang, Qi Jin, Zichun Xiang, Yongjun Li, Zhiqiang Wu, Chao Wu, Yiwei Liu); and National Institute for Communicable Disease Control and Prevention (ICDC), China CDC (Zhang Y-Z, Wu, F, Chen Y-M, Pei Y-Y, Xu L, Wang W, Zhao S, Yu B, Hu Y, Tao Z-W, Song Z-G, Tian J-H, Zhang Y-L, Liu Y, Zheng J-J, Dai F-H, Wang Q-M, She J-L and Zhu T-Y)
We thank Marta Zuchowski, Sigrid Kersten, and Joerg Hofmann for help with sample logistics. In vitro-transcribed control RNA for the E gene assay can be acquired from author C. D. through the European Virus Archive platform (www.eu- ropean-virus-archive.com),
Conflict of interest **
Olfert Landt is CEO of Tib-Molbiol; Marco Kaiser is senior re- searcher at GenExpress and serves as scientific advisor for Tib-Molbiol.
Authors’ contributions
VMC: Planned and conducted experiments, conceptualised the laboratory work
OL: Planned and conducted experiments, conceptualised the laboratory work
MK: Planned and conducted experiments
RM: Planned and conducted experiments, conceptualised the laboratory work
AM: Planned and conducted experiments, conceptualised the laboratory work
DKWC: Planned and conducted experiments
TB: Planned and conducted experiments
SB: Planned and conducted experiments
JS: Planned and conducted experiments
MLS: Planned and conducted experiments
DGJCM: Planned and conducted experiments
BLH: Planned and conducted experiments
BvdV: Planned and conducted experiments
SvdB: Planned and conducted experiments
LW: Planned and conducted experiments
GG: Planned and conducted experiments
JLR: Contributed to overall study conceptualization
www.eurosurveillance.org
29
JE: Planned and conducted experiments, conceptualised the laboratory work
MZ: Planned laboratory work, contributed to overall study conceptualization
MP: Planned laboratory work, contributed to overall study conceptualization
HG: Contributed to overall study conceptualization
CR: Planned experiments, conceptualised the laboratory work
MPGK: Planned experiments, conceptualised the laboratory work
CD: Planned experiments, conceptualised the laboratory work, conceptualised the overall study, wrote the manuscript draft.
References
- World Health Organization (WHO). Coronavirus. Geneva: WHO; 2020 [Accessed 21 Jan 2020]. Available from: https://www. who.int/health-topics/coronavirus
- Zhang Y-Z. Novel 2019 coronavirus genome. Virological. [Accessed 21 Jan 2020]. Available from: http://virological. org/t/novel-2019-coronavirus-genome/319
- de Groot RJ, Baker SC, Baric R, Enjuanes L, Gorbalenya AE, Holmes KV, et al. Family Coronaviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ. Virus taxonomy: classification and nomenclature of viruses: ninth report of the International Committee on Taxonomy of Viruses. London; Waltham: Academic Press; 2012. p. 806-20.
- Peiris JS, Yuen KY, Osterhaus AD, Stöhr K. The severe acute respiratory syndrome. N Engl J Med. 2003;349(25):2431-41. https://doi.org/10.1056/NEJMra032498 PMID: 14681510
- World Health Organization. (WHO. Novel Coronavirus (2019- nCoV). Situation report – 1. Geneva: WHO; 21 Jan 2020. Available from: https://www.who.int/docs/default-source/ coronaviruse/situation-reports/20200121-sitrep-1-2019-ncov. pdf
- Abbott A. SARS testing: First past the post. Nature. 2003;423(6936):114. https://doi.org/10.1038/423114a PMID: 12736651
- Corman VM, Müller MA, Costabel U, Timm J, Binger T,
Meyer B, et al. Assays for laboratory confirmation of novel human coronavirus (hCoV-EMC) infections. Euro Surveill. 2012;17(49):20334. https://doi.org/10.2807/ese.17.49.20334- en PMID: 23231891 - Drosten C, Günther S, Preiser W, van der Werf S, Brodt
HR, Becker S, et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N Engl J Med. 2003;348(20):1967-76. https://doi.org/10.1056/NEJMoa030747 PMID: 12690091 - Corman VM, Eickmann M, Landt O, Bleicker T, Brünink S, Eschbach-Bludau M, et al. Specific detection by real-time reverse-transcription PCR assays of a novel avian influenza A(H7N9) strain associated with human spillover infections in China. Euro Surveill. 2013;18(16):20461. PMID: 23611031
- Corman VM, Eckerle I, Bleicker T, Zaki A, Landt O, Eschbach- Bludau M, et al. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Euro Surveill. 2012;17(39):20285. https://doi.org/10.2807/ ese.17.39.20285-en PMID: 23041020
- Panning M, Charrel RN, Donoso Mantke O, Landt O, Niedrig M, Drosten C. Coordinated implementation of chikungunya virus reverse transcription-PCR. Emerg Infect Dis. 2009;15(3):469-71. https://doi.org/10.3201/eid1503.081104 PMID: 19239767
- Corman VM, Rasche A, Baronti C, Aldabbagh S, Cadar D, Reusken CB, et al. Assay optimization for molecular detection of Zika virus. Bull World Health Organ. 2016;94(12):880-92. https://doi.org/10.2471/BLT.16.175950 PMID: 27994281
- Drexler JF, Gloza-Rausch F, Glende J, Corman VM, Muth D, Goettsche M, et al. Genomic characterization of severe acute respiratory syndrome-related coronavirus in European bats and classification of coronaviruses based on partial RNA-dependent RNA polymerase gene sequences. J Virol.
2010;84(21):11336-49. https://doi.org/10.1128/JVI.00650-10 PMID: 20686038
14. Muth D, Corman VM, Roth H, Binger T, Dijkman R, Gottula LT, et al. Attenuation of replication by a 29 nucleotide deletion in SARS-coronavirus acquired during the early stages of human- to-human transmission. Sci Rep. 2018;8(1):15177. https://doi. org/10.1038/s41598-018-33487-8 PMID: 30310104
15. Corman VM, Muth D, Niemeyer D, Drosten C. Hosts and sources of endemic human coronaviruses. Adv Virus Res. 2018;100:163- 88. https://doi.org/10.1016/bs.aivir.2018.01.001 PMID: 29551135
16. Drexler JF, Corman VM, Drosten C. Ecology, evolution and classification of bat coronaviruses in the aftermath of SARS. Antiviral Res. 2014;101:45-56. https://doi.org/10.1016/j. antiviral.2013.10.013 PMID: 24184128
17. Cui J, Li F, Shi ZL. Origin and evolution of pathogenic coronaviruses. Nat Rev Microbiol. 2019;17(3):181-92. https:// doi.org/10.1038/s41579-018-0118-9 PMID: 30531947
18. Romette JL, Prat CM, Gould EA, de Lamballerie X, Charrel R, Coutard B, et al. The European Virus Archive goes global: A growing resource for research. Antiviral Res. 2018;158:127- 34. https://doi.org/10.1016/j.antiviral.2018.07.017 PMID: 30059721
19. Alleweldt F, Kara S, Osinski A, Van Baal P, Kellerborg K, Aarestrup FM, et al. Developing a framework to assess the costeffectiveness of COMPARE – a global platform for the exchange of sequence-based pathogen data. Rev Sci Tech. 2017;36(1):311-22. https://doi.org/10.20506/rst.36.1.2631 PMID: 28926006
20. Domingo C, Ellerbrok H, Koopmans M, Nitsche A, Leitmeyer K, Charrel RN, et al. Need for additional capacity and improved capability for molecular detection of yellow fever virus in European Expert Laboratories: External Quality Assessment, March 2018. Euro Surveill. 2018;23(28):1800341. https:// doi.org/10.2807/1560-7917.ES.2018.23.28.1800341 PMID: 30017021
21. Pas SD, Patel P, Reusken C, Domingo C, Corman VM, Drosten C, et al. First international external quality assessment of molecular diagnostics for Mers-CoV. J Clin Virol. 2015;69:81-5. https://doi.org/10.1016/j.jcv.2015.05.022 PMID: 26209385
22. Gobat N, Amuasi J, Yazdanpanah Y, Sigfid L, Davies H, Byrne JP, et al. Advancing preparedness for clinical research during infectious disease epidemics. ERJ Open Res. 2019;5(2):00227- 2018. https://doi.org/10.1183/23120541.00227-2018 PMID: 31123684
License, supplementary material and copyright
This is an open-access article distributed under the terms of the Creative Commons Attribution (CC BY 4.0) Licence. You may share and adapt the material, but must give appropriate credit to the source, provide a link to the licence and indicate if changes were made.
Any supplementary material referenced in the article can be found in the online version.
This article is copyright of the authors or their affiliated in- stitutions, 2020.
30
www.eurosurveillance.org