VIRUS = ESOSOMA – 1) Intervista a DAVID ICKE, 6 aprile 2020, Prima Parte – 2) I VIRUS: La funzione biologica sensata nel nostro organismo – 3) Il Dottor ANDREW KAUFMAN parla della scienza degli ESOSOMI: potrebbero essere la chiave del covid-19? — 4) Bombshell evidenzia che le coppie di basi di RNA COVID sono identiche al DNA umano del CROMOSOMA 8 – 5) SEQUENNZA elementare del test PCR per il CORONAVIRUS si trova in tutti i DNA UMANI! – – – 6) VIRUS e elettrificazione della Terra – Dr. THOMAS COWAN – 7) A Breackdown on Current Testing Procedures – IL COVID-19 è un ESOSOMA – 8) Dr. LORETTA BOLGAN: COVID-19 semplice SPETTATORE – ESOSOMA – CELLULE Vero – 9) Coronavirus: la teoria degli ESOSOMI e quella del virus. Il test PCR è attendibile? — 10) COVID-19 NON è un V IRUS – E’ un ESOSOMA influenzato dalla contaminazione elettromagnetica – NIVES VALLE — 11) ESOSOMI PDB

Bombshell evidenzia che le coppie di basi di RNA COVID sono identiche al DNA umano del cromosoma 8

1520 iscritti

ISCRITTO

Si dice che Covid sia RNA incapsulato che viene utilizzato per copiare il DNA per estrarlo dal nucleo. Il DNA non può lasciare il nucleo. Quindi questa connessione potrebbe essere semplicemente una coincidenza. Quello che sappiamo è che quando iniettiamo in noi RNA o DNA che imita il nostro stesso DNA, otteniamo malattie autoimmuni e sappiamo che i vaccini causeranno questi problemi. Continuiamo a ricercare e imparare ... dott.AMANDHA DAWN VOLLMERha conseguito una laurea in Biotecnologie Arriculturali presso l’Università di Lethbridge e un diploma di Dottore in Medicina Naturopatica presso il Canadian College of Naturopathic Medicine di Toronto. Dopo molti studi accademici e indipendenti, la sua passione per l’elegante ed efficace medicina sub-molecolare nota come omeopatia, l’ha portata a studiare con il gruppo di Bombay in India sotto Rajan Sankaran. Si è anche prestata come volontaria per un programma medico intensivo di un mese nell’India settentrionale, seguendo cardiologi, ostetrici, professionisti ayurvendici e medici omeopatici. Sempre alla ricerca della conoscenza e della verità, Amandha ha presto realizzato informazioni più profonde e nascoste che l’hanno spinta a una ricerca continuamente attiva su molti argomenti diversi, comprese varie forme di diritto, politica, storia, religione e scienza. Ha aiutato molti a curare tutti i tipi di malattie acute e croniche dall’inizio alla fine delle fasi con successo con principi olistici dal 2008. È proprietaria di Yummy Mummy emporium & Apothecary in Ontario, Canada, dove fornisce tutte le soluzioni naturali per la disintossicazione e la guarigione delle malattie . Produce potenti miscele di erbe e ha sviluppato e progettato una linea per la cura del corpo completamente naturale e botanicamente infusa di creme, pomate e oli estremamente efficaci. Da sola produce oltre 100 rimedi potenti e in piccoli lotti che non si trovano da nessun’altra parte. Link Originale https://www.youtube.com/watch?v=5y1Kz… Articolo https://phys.org/news/2020-01-rna-eff…

Modified RNA has a direct effect on DNA

Modified RNA has a direct effect on DNA
Deoxyribonucleic acid (DNA). Credit: Colourbox.com

An article titled “m6A RNA modification as a new player in R-loop regulation,” by the Dynamic Gene Regulation research group led by Arne Klungland at IMB, was published in the January edition of Nature Genetics.

Following a new collaboration between UiO and research groups in Nottingham and Oxford, it has now been revealed that RNA has a direct effect on DNA stability, according to Professor Klungland’s research.

He believes the discovery will provide the health service with an important tool, since many studies have shown that the regulation of modifications to RNA is important for the development of cancer.

If that are important for the chemical compound 6-methyladenine are completely removed, this results in neurodegeneration in both mice and humans.

Where and how

In areas of DNA where RNA binds to one of the DNA threads in such a way that the complementary DNA thread becomes the sole thread (R-loop structures), the DNA stability will change if RNA is chemically modified by m6A.

“Several research groups are now working together to study what effect this can have on the DNA molecule. We already know that R-loop areas are associated with sequences of DNA containing active genes and that this can lead to chromosomal breakage and the loss of genetic information,” explains Klungland.

Modified RNA has a direct effect on DNA
Credit: University of Oslo

New field of research

Normally, epigenetic gene regulation is studied by examining dynamic modifications of DNA and proteins—so-called . The modifications can turn genes on or off without changing the underlying genetic code.

Less than 10 years ago, it was discovered that dynamic modifications also exist in RNA and that these have an important role to play in gene

Important modification

The most common is on mRNA is 6-metyladenin (m6A). It has now been shown that this modification is essential for the survival of cells and model (non-human) organisms.

Over the last five years, there has been an enormous increase in the amount of research into RNA modifications—a field called epitranscriptomics.

One of the first studies in this field of research was the result of a collaboration between research groups in Chicago, Beijing and Oslo (Zheng, Dahl et al., Molecular Cell, 2012, 49, 18-29).


Explore further

Histone modifications are the influencers of zygotic genome awakening


More information: Aline Marnef et al. m6A RNA modification as a new player in R-loop regulation, Nature Genetics (2019). DOI: 10.1038/s41588-019-0563-z

Journal information: Nature Genetics

Scoperta shock sul test Covid: kit tarati per trovare sempre positivi?

Il dubbio sulla attendibilità dei famigerati tamponi utilizzati per il test di positività al Covid-19 è sempre stato al centro dell’attenzione, non solo per i cosiddetti negazionisti (termine denigratorio spesso usato per evitare la trasparenza), ma per coloro che, legittimamente, si pongono sempre domande e che non intendono subire passivamente il pensiero unico narrato dal mainstream.
Secondo una recente ricerca nel database NCBI (National Center for Biotechnology Information) per le sequenze nucleotidiche, sarebbe stata portata alla luce una scoperta veramente sorprendente. Una delle sequenze utilizzate dall’OMS (Organizzazione Mondiale della Sanità) per il noto test PCR per SARS-CoV-2 si troverebbe in tutto il DNA UMANO! Così afferma il Dott. THOMAS COWAN, sintetizzando le sue ricerche.
Secondo questa tesi la sequenza elementare di 18 caratteri “CTCCCTTTGTTGTGTTGT”, si troverebbe proprio NEL DOCUMENTO del PROTOCOLLO del test PCR del coronavirus dell’OMS. Ricordiamo che il REAGENTE CHIMICO necessario ad ANALIZZARE il MATERIALE ORGANICO prelevato dai TAMPONI è fornito SULLA BASE di un PROTOCOLLO dell’OMS. Tale SEQUENZA di 18 CARATTERI viene AMPLIFICATA dal processo PCR per essere rilevata e designata come risultato del TEST POSITIVO”. Accade così che questa IDENTICA SEQUENZA di 18 CARATTERI, letteralmente, si troverebbe anche sul CROMOSOMA 8 dell’HOMO SAPIENS!
«Per quanto ne so – commenta THOMAS COWAN – ciò significa che i KIT di TEST dell’OMS dovrebbero trovare un risultato POSITIVO in TUTTI gli ESSERI UMANI. Qualcuno può spiegarlo diversamente?».

Ecco il video che chiarisce meglio il succo della scoperta:

Sequenza elementare del test PCR per il CORONAVIRUS si trova in tutti i DNA umani!

Protocol: Real-time RT-PCR assays for the detection of SARS-CoV-2 Institut Pasteur, Paris

This protocol describes procedures for the detection of SARS-CoV-2 for two RdRp targets (IP2 and IP4).

Based on the first sequences of SARS-CoV-2 made available on the GISAID database on January 11, 2020, primers and probes (nCoV_IP2 and nCoV_IP4) were designed to target the RdRp gene spanning nt 12621-12727 and 14010-14116 (positions according SARS-CoV, NC_004718).

As a confirmatory assay, we used the E gene assay from the Charité protocol1

page1image3673760

Material

Kits:

Kit Extraction NucleoSpin Dx Virus
SuperScriptTM III Platinum® One-Step Quantitative RT-PCR System

Primers and probes

Ref: Macherey Nagel 740895.50 Ref: Invitrogen 1732-020

Name

Sequences (5′-3′)

page1image1703072 page1image1703488

Length(bases)

PCR product size

Ref.

RdRp gene / nCoV_IP2

page1image3675424 page1image3675840

nCoV_IP2-12669Fw

ATGAGCTTAGTCCTGTTG

17

108 bp

1

nCoV_IP2-12759Rv

CTCCCTTTGTTGTGTTGT

page1image3678128 page1image3678544

18

page1image3679168 page1image3679584

nCoV_IP2-12696bProbe(+)

AGATGTCTTGTGCTGCCGGTA [5′]Hex [3′]BHQ-1

21

page1image3682704 page1image3683120 page1image3683744 page1image3684160

RdRp gene / nCoV_IP4

nCoV_IP4-14059Fw

GGTAACTGGTATGATTTCG

19

107 bp

1

nCoV_IP4-14146Rv

CTGGTCAAGGTTAATATAGG

20

nCoV_IP4-14084Probe(+)

TCATACAAACCACGCCAGG [5′]Fam [3′]BHQ-1

19

page1image3689152 page1image3689568 page1image3690192 page1image3690608

E gene / E_Sarbeco

(CoVE)

E_Sarbeco_F1

ACAGGTACGTTAATAGTTAATAGCGT

page1image3695600 page1image3696016

18

page1image3696640 page1image3697056

125 bp

2

E_Sarbeco_R2

ATATTGCAGCAGTACGCACACA

20

E_Sarbeco_P1

ACACTAGCCATCCTTACTGCGCTTCG [5′]Fam [3′]BHQ-1

20

1/ National Reference Center for Respiratory Viruses, Institut Pasteur, Paris. 2/ Corman et al. Eurosurveillance1

Primer sets nCoV_IP2 and nCoV_IP4 can be multiplexed. Both reaction mixtures are described below.

PCR amplification regions (positions according to SARS-CoV, NC_004718)

nCoV_IP2 / 12621-12727 E gene / 26141-26253 nCoV_IP4 / 14010-14116

NUCLEIC ACID EXTRACTION

RNA is extracted from specimens using the NucleoSpin Dx Virus (Macherey Nagel ref. 740895.50). RNA extractedfrom100μloforiginalsample,iselutedin100μlofelutionbuffer.

1

MIX PREPARATION FOR ALL SEPARATE PRIMER/PROBE COMBINATIONS

All primers and probes described below were validated under the following conditions.

RT-PCR Mix kit:

• Invitrogen SuperscriptTM III Platinum® One-Step qRT-PCR system (ref: 11732-088) Real-time PCR equipment:

• LightCycler 480 (96)

Adjustments may be required for the use of other kits or other real-time PCR instruments. All Assays used the same conditions. Primer and probe sequences, as well as optimized concentrations are shown in table below. A 25μl reaction was set up containing 5μl of RNA.

Simplex Mix Vol (μl) [final]

page2image1648160

H2O PPI

page2image1697456 page2image1697872

3.60

page2image3009024

Reaction mix 2X

page2image1700992 page2image1701408

12.50

page2image1702032 page2image1702448

page2image1702864

3 mM Mg

page2image1703488

MgSO4 (50mM)

0.40

0.8 mM Mg

Forward Primer (10μM)

page2image3672096 page2image3672512

1.00

page2image3698720

0.4 μM

Reverse Primer (10μM)

1.00

0.4 μM

Probe (10μM)

0.50

0.2 μM

SuperscriptIII RT/Platinum Taq Mix

page2image3703296 page2image3703712

1.00

page2image3704544

Final Volume

page2image3706208 page2image3706624

20.00

page2image3708080

Multiplex Mix (nCoV_IP2&IP4) Vol (μl) [final]

H2O PPI

1.3

Reaction mix 2X

12.50

page2image1683312 page2image1693296

3 mM Mg

page2image1694544

MgSO4 (50mM)

0.40

0.8 mM Mg

Forward Primer (10μM)

page2image1694960 page2image1695376

1.00

page2image1696000 page2image1696416

page2image1696832

0.4 μM

page2image3715776

Reverse Primer (10μM)

1.00

0.4 μM

Forward Primer (10μM)

page2image1698496 page2image1698912

1.00

page2image1699744

0.4 μM

Reverse Primer (10μM)

1.00

0.4 μM

Probe (10μM)

page2image3717440 page2image3717856

0.4

page2image3718688

0.16 μM

Probe (10μM)

page2image3719728 page2image3720144

0.4

page2image3720976

0.16 μM

SuperscriptIII RT/Platinum Taq Mix

1.00

Final Volume

page2image3724928 page2image3725344

20.00

page2image3725968 page2image3726384

page2image3726800 page2image2958176

CONTROLS

Each real-time RT-PCR assay includes in addition of unknown samples:

  • Two negative samples bracketing unknown samples during RNA extraction (negativeextraction controls)
  • Positive controls (in duplicate); when using in vitro synthesized transcripts as controlsinclude five quantification positive controls (in duplicate) including 105, 104 and 103copies genome equivalent (ge) of in vitro synthesized RNA transcripts.
  • One negative amplification control.AMPLIFICATION CYCLES (LIGHTCYCLER SYSTEM)
page2image2994464

Reverse transcription

page2image3728672

page2image3729088

55°C

page2image3730128

20 min

x1

Denaturation

95°C

3 min

x1

Amplification

page2image3736992

95°C

page2image3738448

15 sec

x50

page2image3740112

Acquisition

page2image3740736

58°C

30 sec

page2image3741776

Cooling

page2image3004208

page2image3743024

40°C

page2image3744064

30 sec

x1

2

SENSITIVITY

For the nCoV_IP and E_Sarbeco real-time RT-PCR

Sensitivity, in terms of 95% hit rate is about 100 copies of RNA genome equivalent per reaction (this amount of target sequences is always detected), the probability to detect lower amounts of virus decreases, but samples containing 10 copies could be detected with multiplex assay.

page3image3748432 page3image3748224

RNA copies Of transcript 1,00E+07 1,00E+06 1,00E+05 1,00E+04

Multiplex (Ct values)

nCoV_IP2 nCoV_IP4

Simplex (Ct values)

E_Sarbeco

page3image3748016 page3image3748640 page3image3748848 page3image3749056 page3image3749264 page3image3749472 page3image3749680

21,67 21,97 page3image374988824,72 24,97 25,12 page3image375009628,19 28,00 27,88 page3image375030430,96 31,84 30,51 page3image375051233,33

Ct values may vary from instrument to instrument by up to 2 cycles, while the interval between two dilutions steps is constant (∆Ct).

SPECIFICITY

Cross-reactivity with other respiratory viruses was tested with specimens known to be positive for a panel of respiratory viruses (influenza A(H1N1)pdm09, A(H3N2), B-Victoria, B-Yamagata; influenza C; RSV A, B; hBoV; hPIV; hMPV; HRV/enterovirus; adenovirus; hCoV (HKU1, OC43, 229E and NL63); MERS-CoV. None of the tested viruses showed reactivity with PCR2 and PCR4.

POSITIVE CONTROL FOR SARS-CoV-2 REAL-TIME RT-PCR

One specific control has been designated.

Positive control for real-time RT-PCR is an in vitro transcribed RNA derived from strain BetaCoV_Wuhan_WIV04_2019 (EPI_ISL_402124). The transcript contains the amplification regions of the RdRp and E gene as positive strand. Each microtube contains 1011 copies of target sequences diluted in yeast tRNA, and lyophilised.

Reconstitution of transcribed RNA
Add 100 μl of RNase/DNAse-free H2O to obtain a solution at a concentration of 109 copies/μl. Store at -80°C. Dilute to prepare a master bank at 2×106 copies/μl. Store at -80°C.
From this prepare a working bank of reagent at 2×104 copies/μl in order to avoid freeze/thaw cycles. Workingtubesmaybestoredat-20°Cforlessthanoneweek.

Positive controls are available upon request ([email protected])

Aknowledgements

We gratefully acknowledge the Authors, the Originating and Submitting Laboratories for their sequence and metadata shared through GISAID (EPI_ISL_402119; EPI_ISL_402121; EPI_ISL_402120; EPI_ISL_402123; EPI_ISL_402124; EPI_ISL_402125).

Reference

1- Corman VM, Landt O, Kaiser M, et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 2020;25.

page3image3750720 page3image3750928

3

 

Nucleotide

All DatabasesAssemblyBiocollectionsBioProjectBioSampleBioSystemsBooksClinVarConserved DomainsdbGaPdbVarGeneGenomeGEO DataSetsGEO ProfilesGTRHomoloGeneIdentical Protein GroupsMedGenMeSHNCBI Web SiteNLM CatalogNucleotideOMIMPMCPopSetProteinProtein ClustersPubChem BioAssayPubChem CompoundPubChem SubstancePubMedSNPSparcleSRAStructureTaxonomyToolKitToolKitAllToolKitBookgh

Clear input

COVID-19 is an emerging, rapidly evolving situation.
Get the latest public health information from CDC: 
https://www.coronavirus.gov .
Get the latest research from NIH: 
https://www.nih.gov/coronavirus.
Find NCBI SARS-CoV-2 literature, sequence, and clinical content: 
https://www.ncbi.nlm.nih.gov/sars-cov-2/.


  • Due to the large size of this record, sequence and annotated features are not shown. Use the “Customize view” panel to change the display.

Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly

NCBI Reference Sequence: NC_000008.11

FASTA Graphics

LOCUS       NC_000008                 18 bp    DNA     linear   CON 17-AUG-2020
DEFINITION  Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly.
ACCESSION   NC_000008 REGION: 63648346..63648363
VERSION     NC_000008.11
DBLINK      BioProject: PRJNA168
            Assembly: GCF_000001405.39
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 18)
  AUTHORS   Nusbaum,C., Mikkelsen,T.S., Zody,M.C., Asakawa,S., Taudien,S.,
            Garber,M., Kodira,C.D., Schueler,M.G., Shimizu,A., Whittaker,C.A.,
            Chang,J.L., Cuomo,C.A., Dewar,K., FitzGerald,M.G., Yang,X.,
            Allen,N.R., Anderson,S., Asakawa,T., Blechschmidt,K., Bloom,T.,
            Borowsky,M.L., Butler,J., Cook,A., Corum,B., DeArellano,K.,
            DeCaprio,D., Dooley,K.T., Dorris,L. III, Engels,R., Glockner,G.,
            Hafez,N., Hagopian,D.S., Hall,J.L., Ishikawa,S.K., Jaffe,D.B.,
            Kamat,A., Kudoh,J., Lehmann,R., Lokitsang,T., Macdonald,P.,
            Major,J.E., Matthews,C.D., Mauceli,E., Menzel,U., Mihalev,A.H.,
            Minoshima,S., Murayama,Y., Naylor,J.W., Nicol,R., Nguyen,C.,
            O'Leary,S.B., O'Neill,K., Parker,S.C., Polley,A., Raymond,C.K.,
            Reichwald,K., Rodriguez,J., Sasaki,T., Schilhabel,M., Siddiqui,R.,
            Smith,C.L., Sneddon,T.P., Talamas,J.A., Tenzin,P., Topham,K.,
            Venkataraman,V., Wen,G., Yamazaki,S., Young,S.K., Zeng,Q.,
            Zimmer,A.R., Rosenthal,A., Birren,B.W., Platzer,M., Shimizu,N. and
            Lander,E.S.
  TITLE     DNA sequence and analysis of human chromosome 8
  JOURNAL   Nature 439 (7074), 331-335 (2006)
   PUBMED   16421571
REFERENCE   2  (bases 1 to 18)
  CONSRTM   International Human Genome Sequencing Consortium
  TITLE     Finishing the euchromatic sequence of the human genome
  JOURNAL   Nature 431 (7011), 931-945 (2004)
   PUBMED   15496913
REFERENCE   3  (bases 1 to 18)
  AUTHORS   Lander,E.S., Linton,L.M., Birren,B., Nusbaum,C., Zody,M.C.,
            Baldwin,J., Devon,K., Dewar,K., Doyle,M., FitzHugh,W., Funke,R.,
            Gage,D., Harris,K., Heaford,A., Howland,J., Kann,L., Lehoczky,J.,
            LeVine,R., McEwan,P., McKernan,K., Meldrim,J., Mesirov,J.P.,
            Miranda,C., Morris,W., Naylor,J., Raymond,C., Rosetti,M.,
            Santos,R., Sheridan,A., Sougnez,C., Stange-Thomann,N.,
            Stojanovic,N., Subramanian,A., Wyman,D., Rogers,J., Sulston,J.,
            Ainscough,R., Beck,S., Bentley,D., Burton,J., Clee,C., Carter,N.,
            Coulson,A., Deadman,R., Deloukas,P., Dunham,A., Dunham,I.,
            Durbin,R., French,L., Grafham,D., Gregory,S., Hubbard,T.,
            Humphray,S., Hunt,A., Jones,M., Lloyd,C., McMurray,A., Matthews,L.,
            Mercer,S., Milne,S., Mullikin,J.C., Mungall,A., Plumb,R., Ross,M.,
            Shownkeen,R., Sims,S., Waterston,R.H., Wilson,R.K., Hillier,L.W.,
            McPherson,J.D., Marra,M.A., Mardis,E.R., Fulton,L.A.,
            Chinwalla,A.T., Pepin,K.H., Gish,W.R., Chissoe,S.L., Wendl,M.C.,
            Delehaunty,K.D., Miner,T.L., Delehaunty,A., Kramer,J.B., Cook,L.L.,
            Fulton,R.S., Johnson,D.L., Minx,P.J., Clifton,S.W., Hawkins,T.,
            Branscomb,E., Predki,P., Richardson,P., Wenning,S., Slezak,T.,
            Doggett,N., Cheng,J.F., Olsen,A., Lucas,S., Elkin,C.,
            Uberbacher,E., Frazier,M., Gibbs,R.A., Muzny,D.M., Scherer,S.E.,
            Bouck,J.B., Sodergren,E.J., Worley,K.C., Rives,C.M., Gorrell,J.H.,
            Metzker,M.L., Naylor,S.L., Kucherlapati,R.S., Nelson,D.L.,
            Weinstock,G.M., Sakaki,Y., Fujiyama,A., Hattori,M., Yada,T.,
            Toyoda,A., Itoh,T., Kawagoe,C., Watanabe,H., Totoki,Y., Taylor,T.,
            Weissenbach,J., Heilig,R., Saurin,W., Artiguenave,F., Brottier,P.,
            Bruls,T., Pelletier,E., Robert,C., Wincker,P., Smith,D.R.,
            Doucette-Stamm,L., Rubenfield,M., Weinstock,K., Lee,H.M.,
            Dubois,J., Rosenthal,A., Platzer,M., Nyakatura,G., Taudien,S.,
            Rump,A., Yang,H., Yu,J., Wang,J., Huang,G., Gu,J., Hood,L.,
            Rowen,L., Madan,A., Qin,S., Davis,R.W., Federspiel,N.A.,
            Abola,A.P., Proctor,M.J., Myers,R.M., Schmutz,J., Dickson,M.,
            Grimwood,J., Cox,D.R., Olson,M.V., Kaul,R., Raymond,C., Shimizu,N.,
            Kawasaki,K., Minoshima,S., Evans,G.A., Athanasiou,M., Schultz,R.,
            Roe,B.A., Chen,F., Pan,H., Ramser,J., Lehrach,H., Reinhardt,R.,
            McCombie,W.R., de la Bastide,M., Dedhia,N., Blocker,H.,
            Hornischer,K., Nordsiek,G., Agarwala,R., Aravind,L., Bailey,J.A.,
            Bateman,A., Batzoglou,S., Birney,E., Bork,P., Brown,D.G.,
            Burge,C.B., Cerutti,L., Chen,H.C., Church,D., Clamp,M.,
            Copley,R.R., Doerks,T., Eddy,S.R., Eichler,E.E., Furey,T.S.,
            Galagan,J., Gilbert,J.G., Harmon,C., Hayashizaki,Y., Haussler,D.,
            Hermjakob,H., Hokamp,K., Jang,W., Johnson,L.S., Jones,T.A.,
            Kasif,S., Kaspryzk,A., Kennedy,S., Kent,W.J., Kitts,P.,
            Koonin,E.V., Korf,I., Kulp,D., Lancet,D., Lowe,T.M., McLysaght,A.,
            Mikkelsen,T., Moran,J.V., Mulder,N., Pollara,V.J., Ponting,C.P.,
            Schuler,G., Schultz,J., Slater,G., Smit,A.F., Stupka,E.,
            Szustakowski,J., Thierry-Mieg,D., Thierry-Mieg,J., Wagner,L.,
            Wallis,J., Wheeler,R., Williams,A., Wolf,Y.I., Wolfe,K.H.,
            Yang,S.P., Yeh,R.F., Collins,F., Guyer,M.S., Peterson,J.,
            Felsenfeld,A., Wetterstrand,K.A., Patrinos,A., Morgan,M.J., de
            Jong,P., Catanese,J.J., Osoegawa,K., Shizuya,H., Choi,S. and
            Chen,Y.J.
  CONSRTM   International Human Genome Sequencing Consortium
  TITLE     Initial sequencing and analysis of the human genome
  JOURNAL   Nature 409 (6822), 860-921 (2001)
   PUBMED   11237011
  REMARK    Erratum:[Nature 2001 Aug 2;412(6846):565]
COMMENT     REFSEQ INFORMATION: The reference sequence is identical to
            CM000670.2.
            On Feb 3, 2014 this sequence version replaced NC_000008.10.
            Assembly Name: GRCh38.p13 Primary Assembly
            The DNA sequence is composed of genomic sequence, primarily
            finished clones that were sequenced as part of the Human Genome
            Project. PCR products and WGS shotgun sequence have been added
            where necessary to fill gaps or correct errors. All such additions
            are manually curated by GRC staff. For more information see:
            https://genomereference.org.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200815
            Annotation Version          :: 109.20200815
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..18
                     /organism="Homo sapiens"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
ORIGIN      
        1 ctccctttgt tgtgttgt

Dr. THOMAS COWAN ha detto:

Dopo l’enorme pandemia dell’INFLUENZA SPAGNOLA del 1918, hanno chiesto a RUDOLF STEINER a cosa fosse dovuta. E lui rispose: I VIRUS sono semplicemente le ESCREZIONI di una CELLULA AVVELENATA. I VIRUS sono delle parti di DNA o RNA, o di qualche altra proteina, che vengono espulsi dalla cellula. Si formano quando la cellula è avvelenata. NON SONO la CAUSA di NIENTE. Perché è ciò che succede. Le CELLULE si ritrovano avvelenate e cercano di pulirsi eliminando i DETRITI che chiamiamo VIRUS. Se date un’occhiata alle teorie correnti sui VIRUS che sono chiamati ESOSOMI, l’ultima conferenza del NIH (Dipartimento della salute degli USA) che parla della complessità del virus. Vedrete che corrisponde esattamente alle teorie correnti su cosa sono realmente i virus. Le MALATTIE sono causate da un AVVELENAMENTO. Alla FINE dell’AUTUNNO 2017 c’è stata l’introduzione delle ONDE RADIO intorno al mondo. Quando esponete un qualsiasi essere vivente ad un nuovo campo elettromagnetico, lo avvelenate. PERCHE’ VIRALE? Perché la gente è stata avvelenata. Le persone espellono delle TOSSINE che assomigliano a dei VIRUS.

Nel 1918, il MINISTERO della SANITA’ di BOSTON ha deciso di ANALIZZARE la caratteristica CONTAGIOSITA’ di una EPIDEMIA. Hanno preso centinaia di PERSONE che avevano l’INFLUENZA, hanno prelevato ciò che avevano nel naso e l’hanno iniettato a dei soggetti sani che non avevano l’influenza e neanche una volta sono riusciti a far ammalare qualcuno. L’hanno ripetuto più e più volte e non sono riusciti a dimostrare il contagio. L’hanno pure fatto con dei CAVALLI che sembrava avessero preso l’INFLUENZA SPAGNOLA. Hanno messo dei sacchi sulle teste dei cavalli e il cavallo starnutiva dentro il sacco e infilavano il sacco al cavallo seguente e nessun cavallo (sano) si è ammalato. Potete leggere tutto ciò in un libro che si chiama L’ARCOBALENO INVISIBILE” di ARTHUR FURSTENBERG. Ha tenuto una cronica di tutti gli stadi dell’elettrificazione della Terra.

3)

Dr.ssa LORETTA BOLGAN

Da guardare con attenzione.

Ad oggi in realtà non sappiamo ancora con certezza qual è la causa dei decessi per ciò che abbiamo definito Covid-19. Il VIRUS SARS-CoV-2 potrebbe essere una concausa o un SEMPLICE “SPETTATORE” nello scatenamento della malattia, in cui il virus (e non necessariamente il SARS-Cov-2, potrebbe trattarsi anche di altre infezioni) insieme ad altri fattori scatenanti ha portato l’organismo a causare una forte reazione autoimmune/infiammatoria, con il rilascio dalle cellule di ciò che sappiamo essere gli ESOSOMI e che vengono INTERPRETATI come la PROVA del rilascio dalle cellule delle PARTICELLE VIRALI.
Ricordo che ad oggi il test in RT-PCR NON è ancora stato VALIDATO verso il GOLD STANDARD, nè dal punto di vista analitico nè clinico. E’ doveroso ricordare il fatto che sebbene fin dall’inizio la ricerca si sia concentrata nella caccia al coronavirus e soprattutto alla messa a punto del TEST in RT-PCR, NON SIGNIFICA necessariamente CHE SIA l’AGENTE CAUSALE (o concausale) del COVID-19.
Inutile dire che il TEST ANTICORPALE NON è di alcuna UTILITÀ in questo momento, quando gli sforzi analitici dovrebbero essere orientati a capire i FATTORI (infettivi, ambientali, di predisposizione individuale) CHE PORTANO al DECESSO e NON a FARE un’INDAGINE EPIDEMIOLOGICA con un numero di FALSI POSITIVI INDEFINITO (ricordo che, come ho riportato in altri post, gli ANTICORPI ANTI-COVID-2 cross REAGISCONO CON ALTRI CORONAVIRUS, che rappresentano una percentuale significativa dei VIRUS PARA-INFLUENZALI, e CON gli AUTO-ANTICORPI di DIVERSE MALATTIE AUTO-IMMUNI).

Il RILASCIO di ESOSOMI è un meccanismo che si osserva normalmente quando si lavora con le CELLULE TUMORALI in COLTURA, le quali lo utilizzano per ELIMINARE le SOSTANZE TOSSICHE (chemioterapici) CHE POTREBBERO UCCIDERLE, e per l’ISOLAMENTO del VIRUS sono state utilizzate le CELLULE Vero, ben nota linea cellulare tumorale (vedi foto Spallanzani).

https://drive.google.com/file/d/1SXe2VcQDYgfyKAdtDaB8jYFdT0emD5pD/view?fbclid=IwAR0TqQy7xYee50bSX-Nz9Y8HiGyUqgqxtNZiMKbyK4GqRqYBpfw_n0h4mP

 

Coronavirus: la teoria degli ESOSOMI e quella del virus. Il test PCR è attendibile?

Scritto da Cristina Bassi

Quanto segue è la mia traduzione e sintesi  del video “Should you take the COVID19 Test?” (dovresti farti fare il test covid-19?), in cui si affronta la teoria degli ESOSOMI, che già il dr dr Kaufman, dagli USA, rese nota di recente.

Le affermazioni del dr Kaufman furono riferite piu volte anche da David Icke, particolarmente nei talk-intervista  a LondonReal, quelle stesse interviste che hanno avuto milioni di ascolti e che sono state bannate da youtube [attualmente, 18.5.20, il sito di Icke è crollato, 250milioni di richieste in 24 ore… il server sotto attacco].

Come si legge alla fine del presente video che traduco (min 8’48”), i concetti esposti nel video, si basano sulla ricerca e contributi di:
David Crowe, www.theinfectiousmyth.com;
Dr Tom Cowan –
www.drtomcowan.com;
Dr Andrew Kaufman –
www.andrewkaufmanmd.com;
Jon Rappoport
– www.nomorefakenews.com

Si tratta di informazioni chiare e interessanti sul tema corona virus, pensate dall’autore del video per il pubblico USA e che possiamo acquisire anche noi per arricchire il nostro senso critico, conoscenza e valutazione, oltre la cortina della “scienzah” corrente…

Passato il grande panico e la pressione iniziale dell’era covid nella penisola italica, ora emergono una serie di interrogativi inquietanti sulla correttezza delle diagnosi iniziali e conseguente corretta terapia. A tal fine si vedano in rete i molti contributi di medici ed esperti di scienza, raccolti spesso nelle interviste di byoblu e anche su questo sito  (vedi alle voci in search per  coronavirus e covid)

Viviamo in condizioni altamente tossiche. Le cellule devono piegarsi a questo dato di fatto e rispondere a questa situazione, per questo del materiale genetico tossico sia esso RNA o DNA, viene “impacchettato” ed espulso dalla cellula in piccolissime palline

Chiamiamo questo materiale genetico ESOSOMI, che immaginiamo possano fungere da messaggeri per allertare altre cellule su particolari veleni/tossine, cosi sempre piu cellule impacchettano il materiale e lo rilasciano.

Dato il ciclo delle temperature in alcuni momenti dell’anno, gli esseri umani tendono a liberarsi di questo materiale genetico e questo finisce col manifestarsi con sintomi di malattia.

Questi esosomi NON sono infettivi e non causano malattia anche se sembra si diffondano in tutto il corpo. Fin qui la teoria degli ESOSOMI.

La teoria ufficiale del virus

Adesso guardiamo invece la teoria ufficiale sui virus

I virus vengono considerati come “non vivi”, non hanno una struttura cellulare, e non si riproducono da soli

Ma ne abbiamo trilioni nel corpo. Sono piccolissime parti di materiale genetico, sia di RNA o DNA, impacchettate in piccole palline di proteine che paiono entrare ed uscire dalle cellule.

Vi dice qualcosa che abbiamo già visto?

 

Crediamo che parte di queste entità siano infettive e patogene e che si trasmettano tra umani  e si riproducano dentro i corpi causando malattia e morte

Guardiamo ora la situazione con il corona virus, guardiamola con entrambe queste due teorie e vediamo che accade.

Consideriamo prima la storia dell’origine del corona virus: un gruppo di persone ebbe una malattia respiratoria, non risolta da antibiotici e cosi del personale medico cominciò’ a cercare ovviamente il virus.

Cosa che in realtà fu poi trovato grazie all’elettroscopio: piccole palline proteiche espulse dalla cellula

Primo paragone: tutto ciò ha senso in entrambe le teorie, quella degli esosomi e quella del virus.

Poi hanno cercato e trovato un frammento di RNA, che non avevano visto prima in alcuni di questi pazienti. Questo ha senso, di nuovo, in entrambe le teorie: quella degli esosomi e quella del virus

Non hanno però dimostrato di poter infettare qualcuno o un animale,con una forma purificata di questo cosiddetto virus .

Sono solo partiti dal presupposto che questo frammento RNA fosse la causa della malattia che avevano visto in alcuni pazienti.

Altrettanto hanno ipotizzato che fosse contagioso.

 

Come funzionano i test

Sapete come funzionano i test? (al min 2’24”)

Non è un test binario come quello della gravidanza, si chiama test PCR e riguarda materiale genetico amplificato, che viene duplicato in dozzine di cicli, fino ad ottenere miliardi o trilioni delle molecole originali.

Usa poi quei risultati per determinare se il soggetto ha abbastanza quantità del frammento di RNA identificato, perchè cosi venga considerato “positivo”.

Ecco la faccenda: ad un certo punto della amplificazione, tutti risulterebbero positivi al test. Usano una soglia arbitraria in cui poi fermare la duplicazione del materiale.

Questa soglia è diversa tra i vari test del covid-19. Infatti ci sono state 10 diverse soglie tra 33 test approvati dalla FDA.  Un po’ strano il tutto, no?

Potreste trovare interessante il fatto che l’inventore del test (min 4′) e vincitore del Nobel non credeva che questo test dovesse essere usato per diagnosticare malattie infettive.

E forse avete sentito di alcuni problemi con questo test, come ad esempio l’alto tasso di falsi positivi.

In ogni caso diciamo che dopo 37 volte in cui un materiale genetico specifico viene duplicato, materiale che hanno trovato nel vostro corpo, questo determini poi che voi abbiate abbastanza di quell’RNA che stanno cercando, cosi da poter essere considerati “positivi”.

Questo poterebbe aver senso in entrambe le teorie sia degli esosomi che del virus.

 

Ma certamente ci sono molte persone che si ammalano, guardate per esempio a New York City, perciò “deve” essere un virus.

Se venite avvelenati da qualcosa nel vostro ambiente, è probabile che anche quelli intorno a voi lo siano. E se poi normalmente ci depuriamo da questi veleni, in alcuni momenti specifici dell’anno, molti potrebbero avere improvvisamente sintomi di malattia

Questo combacia con entrambe le teorie.

Ma occupiamoci adesso della nave da crociere DIMOND PRINCESS (min 5′ ca): sapevate che le persone che stavano stivate per giorni, avevano dei risultati di  test in conflitto tra loro, ovvero sia positivi che negativi?

Come poteva una persona avere questa malattia cosi altamente infettiva e al contempo non trasmetterla a quelli che come lei erano impacchettati nelle cabine per giorni?

Per questo avrebbe senso la teoria degli esososomi, in cui le palline di proteine non sono contagiose, ma non avrebbe senso per la teoria del virus, dove queste stesse palline si suppone siano altamente infettive.

Osserviamo ora il primo caso di trasmissione in Illinois. (min 5’58”)

Una donna che era stata a Wuhan, tornò e sia lei che il marito, cronicamente malato, risultarono positivi al test.

Le autorità mediche tracciarono quindi piu’ di 300 persone, che con loro avevano avuto stretti contatti, per vedere chi aveva acquisito il virus. E pensa un po’… zero positivi.

Di nuovo tutto ciò avrebbe senso nella teoria degli esosomi, perchè questi non sono contagiosi, ma non cosi per la teoria dei virus dato che si suppone che lo sia.

Sapete che infatti ci sono molti casi documentati , in tutto il mondo, di pazienti che risultano positivi a questo frammento RNA, senza avere una rilevante storia di  viaggi e senza contatti noti con qualcuno con infezione?

Persone che dal nulla risultano improvvisamente positive. Di nuovo tutto ciò avrebbe senso nella teoria degli esosomi, dove l’RNA viene prodotta da dentro noi stessi, come una risposta immunitaria.

Ma non avrebbe senso nella teoria del virus, dove si suppone che la persona abbia avuto contatto con qualcuno con il virus.

 

Risultano positivi ma non si ammalano

E che dire con l’alto tasso di persone che risultano positive ma che non si ammalano? L’80% dei pazienti positivi, asintomatici o che hanno leggeri sintomi di raffreddore. Perchè questo?

Di nuovo questo avrebbe senso nella teoria degli esosomi, perchè i frammenti di RNA non sono cause di malattia. Ma non avrebbe senso per la teoria del virus, per cui questo virus causerebbe malattia.

Sempre più strana si fa la faccenda…

Sapevate che alcuni risultano prima positivi e poi negativi e poi ancora positivi in capo a pochi giorni?

Questo avrebbe senso per la teoria degli esosomi, per cui le cellule rilasciano sempre piu o meno questi esosomi che dipendono da certe condizioni.

NON ha senso invece per la teoria del virus, per cui si presume che tu venga infettato, finchè non riesci a liberarti del virus.

Quale delle due teorie vi pare piu probabile? E che direste se sentiste virologi dire (min 8’08”) che credono che i virus siano in realtà esosomi?

Che direste se vi dicessi che anche medici (min 8’11”) ed altri esperti di scienza, ci credono?

In conclusione…al di la della teoria in cui credere, se la teoria ufficiale del virus infettivo, o la teoria emergente degli esosomi, quanto vi sentite al sicuro a fare il test PCR?

Vi interessa veramente avere la vostra vita in balia dei risultati che avete da un test come questo, che potenzialmente pare insignificante?

Volete che i vostri cari vengano testati? Volete il test o forse dobbiamo rifiutarlo?

Fonte: https://www.youtube.com/watch?v=V1Im7jsW9_Y

Traduzione e sintesi: M. Cristina Bassi per www.thelivingspirits.net

19.5.20 : Aggiungo nel seguito un commento della Dr.sa Loretta Bolgan, da FB, al presente articolo:
“In realtà hanno dimostrato su tre modelli animali che il virus è infettivo e causa una patologia molto simile al Covid-19. Gli esosomi contengono normalmente materiale genetico da DNA umano, anche alcuni virus sfruttano gli esosomi per infettare le cellule. In ogni caso per confermare questa teoria bisognerebbe estrarre e purificare gli esosomi e sequenziarne il contenuto. Rimane peró aperta questa domanda: il SARS-Cov-2 è un virus animale e le cellule umane non producono virus animali, al limite possono produrre del materiale genetico trasmissibile, più corto del SARS-Cov-2, ma sempre di origine umana. Quindi non puó trattarsi di una tossina prodotta dalle cellule. A meno che non vogliamo mettiamo in discussione l’esistenza dei virus, ma in questo caso l’esistenza degli esosomi non esclude l’esistenza del virus. Penso che bisogna fare delle distinzioni all’interno dell’argomento. Il virus per esserci c’è, è stato sequenziato per intero nei tessuti e studiate le mutazioni, è stato isolato e negli animali che sono stati contagiati ha causato una sintomatologia simile al Covid-19. Quindi fin qui direi che si puó mettere in discussione che faccia altrettanto nell’uomo finchè non avremo i dati del sequenziamento sui tessuti, e lo studio della capacitá infettiva del virus isolato in vivo. Sappiamo che per l’omologia di sequenza molto elevata con SARS di pipistrelli è un virus animale e quindi nelle cellule umane in qualche modo ci deve entrare, non è una tossina umana. Penso che bisogni fare uno studio serio di sequenziamento e capacità infettiva del materiale genetico per capire meglio. Affermare che non esiste senza aver fatto questi studi non è sufficiente per escluderne l’esistenza”
——————————————————————————————————-
NIVES VALLE ha scritto:
CORONAVIRUS È UN ESOSOMA
COVID-19 non è un virus, è un ESOSOMA influenzato dalla contaminazione elettromagnetica.
Allo stesso tempo in cui ci viene imposta la tecnologia 5G, vengono pubblicati numerosi studi scientifici che avvertono degli effetti negativi dell’inquinamento elettromagnetico sulla salute.
Qualcosa non va.
È l’inquinamento che indebolisce il sistema immunitario e, di conseguenza, le persone muoiono per varie cause, compresa l’influenza stagionale, e tutte le morti sono etichettate come coronavirus.Ricercatori e scienziati come Magda Havas, Annie Sasco, David Carpenter o Ceferino Maestú, che hanno partecipato alla II Conferenza scientifica organizzata dall’Associazione elettro-chimica sensibile per il diritto alla salute (EQSDS) a Segovia settembre-2019, hanno avvertito che la tecnologia 5G sarà accompagnata da un aumento di una varietà di patologie, dall’infertilità alle malattie neurologiche al cancro.
“È una truffa.E peggiorerà, perché distogliendo la nostra attenzione dalle vere cause, il problema peggiorerà. Quando il 5G sarà completamente dispiegato sulla Terra e nello spazio, centinaia di milioni di persone moriranno e un’altra pandemia verrà incolpata. Non è un virus, è un’arma elettromagnetica”, hanno indicato.CONGRESSO DI ARRESTO 5G
È la contaminazione (fracking, scie chimiche, glifosato, additivi tossici negli alimenti, medicine e vaccini, ecc.) e soprattutto la contaminazione elettromagnetica (telefoni cellulari, wi-fi, ecc.), l’elemento chiave, poichè è responsabile della sua trasmissione dall’atmosfera, abbassando il pH del corpo e indebolendo così il sistema immunitario.Abbassando il pH, la solubilità dell’ossigeno nel corpo viene notevolmente ridotta. La cellula ha bisogno di ossigeno, alcalinità e sostanze nutritive, alcune delle quali sono oligoelementi, presenti nell’acqua di mare (terapia di René Quinton). Un pH acido provoca ipertensione, diabete, cancro, malattie cardiache e consente la proliferazione di tutti i tipi di agenti patogeni. Arthur Firstenberg, nel suo libro The Invisible Rainbow, dimostra che questi “fattori di rischio” sono causati da campi elettromagnetici artificiali.Un sistema immunitario sano può far fronte a qualsiasi virus. Inoltre, secondo Rudolf Steiner i virus non sono nemmeno presenti come agenti patogeni nell’ambiente, ma particelle innocue escrete dalle cellule per recuperare dall’avvelenamento, incluso l’avvelenamento elettromagnetico, chiamato esosoma, che la cellula rilascia sotto stress, fisico, psicologico o elettromagnetico.
Ma anche i virologi convenzionali ammettono che i coronavirus sono molto comuni e abbastanza innocui. È assurdo che collassino il sistema sanitario, a meno che non funzioni. Due terzi delle persone hanno coronavirus in piccole quantità innocue e sarebbero risultati positivi nei test PCR coronavirus, che, anche escludendo la contaminazione, non rilevano quale variante è o in quale quantità, cioè se la carica virale, che non viene misurata, porta ad ammalarsi.IN REALTÀ, COVID-19
È UN ESOSOMA.
Affinchè il male continui e progredisca, è essenziale essere ignoranti delle vere cause e dei veri responsabili dei problemi, incolpando capri espiatori di ogni tipo. I sintomi, le conseguenze, vengono combattuti, invece di attaccare le cause dei problemi, in modo che continuino e peggiorino. Il male e le bugie sono due facce della stessa medaglia, l’una non può esistere senza l’altra. Ci convincono che ciò che è buono è cattivo e ciò che è cattivo è buono, che ciò che è vero è falso e che ciò che è falso è vero, in modo che noi stessi possiamo peggiorare le cose, credendo di stare facendo la cosa giusta, come con la quarantena controproducente, che espone ancora più persone al wi-fi e ai cellulari mentre privandosi del sole di cui hanno bisogno per sintetizzare la vitamina D3, necessaria per il loro sistema immunitario. Migliaia di bambini che dovrebbero studiare a scuola ora hanno un telefono cellulare in mano. Arriva più inquinamento elettromagnetico. Continuiamo a contribuire a far ammalare la Società sin dalla tenera età.E peggiorerà. È il nuovo 5G che sta facendo ammalare le persone, in Cina, Europa e Stati Uniti. La frequenza 60GHz di 5G è assorbita dagli atomi di ossigeno del nostro corpo, impedendo loro di legarsi ad altri atomi e molecole, come l’emoglobina o la clorofilla. I tessuti viventi soffocano. Esistono già satelliti che coprono l’intera Terra con il 5G e altre decine di migliaia verranno lanciate quest’anno e il prossimo. Con il nostro consenso, controllano i media, le università, l’istruzione, le banche, le religioni, i governi, le società, le organizzazioni internazionali, le mafie, i servizi di intelligence, tutto ciò che detta ciò in cui dobbiamo credere, pensare, dire e fare.Leggi David Icke, perchè senza un po’ di verità finiremo tutti all’inferno. Questo percorso conduce, attraverso la dittatura mondiale, alla fine della specie umana come la conosciamo, alla sua trasformazione in qualcos’altro, compatibile con il deserto tossico e radioattivo che stanno creando. Il male e le bugie possono e progrediranno indefinitamente, ma il corpo umano può resistere solo fino a un certo punto.
Non si rendono davvero conto che, sotto il nostro naso, con una bugia e un’arma elettromagnetica, ci stanno togliendo il mondo, la gioia, il futuro, la libertà, la vita?
Qualcuno si rende conto che le soluzioni proposte, la quarantena, la connettività wireless, i disinfettanti tossici, i vaccini sono controproducenti?Pensi davvero che finirà bene, che riacquisterai la libertà che avevi? Assolutamente no. Forse con un po’ di fortuna ne recupereranno una frazione ora ma, dal momento che funziona, ci saranno più “pandemie”, ogni volta peggiori.
I nazisti di nuovo. Ancora una volta la dittatura. Come per le Falkland, tutti ripetono sempre la stessa cosa, tutti accettano di essere trascinati al macello, tutti ipnotizzati. Nessuno parla di nient’altro. Per il presunto “infetto” locale con Coronavirus, nessuno indaga su altri fattori di rischio: distanza dalla propria abitazione alla più vicina antenna, dieta, farmaci che assumono, vaccini che hanno ricevuto.Qualcuno capisce davvero il livello ridicolo di tutto questo clamore isterico, esagerato, delirante e iper-promosso per un virus che non esiste? È una farsa, una truffa. Questo è il tipico umorismo satanista. Senza dignità o intelligenza, il patetico essere umano obbedisce e si arrende senza combattere. Una specie del genere non merita di sopravvivere. Come dice il giornalista italiano Roberto Quaglia nel suo video Sbalorditive coincidenze, se continuiamo così, l’umanità meriterà il Premio Darwin per le specie che si estinguono per la loro stupidità.
Se si preoccupano così tanto delle persone, perchè non hanno potenziato il sistema immunitario delle persone in modo da non morire di “influenza”?Perché nel 2019 ci sono stati più decessi per influenza ma non avevano importanza, e nel 2020 sì? Perché non esisteva il 5G, e ora siamo a soli dieci anni dal 2030° anniversario della Crocifissione di Cristo. La religione è la peggiore delle malattie mentali. Lasciatelo dire agli ebrei. Non hanno strutture per il 5G nella loro “terra santa”. Confermalo su Internet, per favore.
Godono degli arresti domiciliari non necessari, della dittatura, della Terra senza umani? È per questo che sei venuto al mondo? Vale la pena vivere così? L’essere umano può non essere più intelligente del Neanderthal nel garantire la sua sopravvivenza, ma almeno la sua anima ha abbastanza dignità da non incarnarsi nella futura razza di schiavi artificiali.METRI INTELLIGENTI IBERDROLA 5G
Presto, le aziende elettriche inizieranno a utilizzare la tecnologia 5G per connettersi ai loro contatori intelligenti, che gestiscono le loro frequenze radio attraverso tutti i cavi elettrici delle case, raggiungendo ogni spina della casa. Anche quando dormi, il 5G funzionerà e inquinerà a breve la tua camera da letto.
👑
di: (Nives Valle<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

ESOSOMI

Molecola del Mese
di David S. Goodsell
trad di Mauro Tonellato

Esosomi

 

ESOSOMI


Molecola del Mese di Febbraio 2007
Gli esosomi distruggono le molecole di RNA messaggero dopo che queste hanno esaurito il loro compito

Introduzione
Le informazioni genetiche sono custodite al sicuro all’interno del nucleo di ogni nostra cellula. La maggior parte dell’attività di una cellula, però, avviene fuori dal nucleo: le proteine vengono sintetizzate nel citoplasma, l’energia viene prodotta nei mitocondri, e le interazioni con l’ambiente avvengono sulla superficie cellulare. Per questo il nucleo ha bisogno di comunicare con il resto della cellula. Le molecole di RNA realizzano questa funzione. L’RNA messaggero (mRNA) trasporta le informazioni genetiche dal nucleo al citoplasma dove avviene la sintesi delle proteine. Le informazioni vengono copiate dal DNA all’mRNA, quindi l’RNA messaggero migra fino ai ribosomi, organelli del citoplasma dove avviene la sintesi proteica. Quando ha esaurito il proprio compito, l’mRNA viene distrutto e i nucleotidi che lo compongono vengono riciclati per sintetizzare nuovo RNA messaggero.
Nei batteri l’mRNA ha una vita media molto breve, appena pochi minuti.
Nelle nostre cellule, invece, alcuni mRNA possono sopravvivere anche per ore. Naturalmente questo processo deve essere attentamente controllato se non si vogliono eliminare molecole di mRNA ancora utili. Per questo la distruzione dell’RNA è affidata ad un insieme di enzimi specializzati. Questi passano al vaglio le molecole di RNA, individuano quelle inutili e le tagliano in pezzi.

Distruzione totale
Gli esosomi, come quello mostrato qui a fianco (file PDB 2nn6), sono tra le molecole che distruggono l’RNA inutile. La parte centrale dell’esosoma ha la forma di un cilindro cavo, all’interno del quale è nascosto l’apparato che taglia l’RNA. Il cilindro è composto di sei differenti subunità (blu e viola). Le altre tre subunità (verdi) aiutano a controllare che solo le giuste molecole di RNA possano entrare nella bocca vorace di questo complesso.
L’uso di una molecola a forma di cilindro cavo per controllare la distruzione di altre molecole ci dovrebbe essere familiare, infatti abbiamo già incontrato molecole simili, i proteosomi, che distruggono le proteine inutili (AAA+ Proteasi mdm 8-2006).

Prepararsi alla distruzione
Prima che un esosoma possa aggredire un RNA messaggero, molti altri enzimi devono attaccare il filamento di RNA e prepararlo per la completa distruzione.
Il primo passo consiste nel rimuovere la lunga sequenzadi nucleotidi di adenina poliA che protegge la parte terminale 3′ delle molecole di RNA messaggero. Questa viene rimossa da speciali ribonucleasi di deadenilazione come quella mostrata qui a fianco sulla sinistra (file PDB 2a1s).
Il secondo passo consiste nel rimuovere il cappuccio 5′(mdm 1-2012) all’altra estremità della catena composto da un nucleotide di guanina attaccati alla rovescia e legato da tre gruppi fosfato. Questo cappuccio viene rimosso da un enzima specializzato come quello mostrato qui a fianco sulla destra (file PDB 1st0).

Esplorando la struttura
La figura qui sotto mostra un esosoma di un archeobatterio (file PDB 2c37). Questo enzima è più semplice di quelli delle nostre cellule. E’ composto da un anello di sei subunità di due tipi simili. La struttura include anche due piccoli tratti di RNA legati in due dei tre siti attivi. Notate che i siti attivi si affacciano sulla superficie interna del canale centrale.

. . . .

La catena proteica dell’esosoma lega le catene di RNA grazie ad una serie di amminoacidi basici, nella figura qui sotto si vedono ben sette arginine rosa e blu, che vengono a trovarsi vicine ai gruppi fosfato acidi dell’RNA. L’RNA è quindi trattenuto nel sito attivo dai legami elettrostatici tra i suoi gruppi fosfato negativi (sfere arancioni e rosse) e gli atomi di azoto positivi delle arginine (rosa e blu).



Bibliografia
K. Buttner, K. Wenig and K.-P. Hopfner (2006) The exosome: a macromolecular cage for controlled RNA degradation. Molecular Microbiology61, 1372-1379.
E. Lorentzen, E. Conti (2006) The exosome and the proteosome: nano-compartments for degradation. Cell125, 651-654.
M. J. Moore (2005) From birth to death: the complex lives of eukaryotic mRNAs. Science309, 1514-1518.

spazio

Molecola del Mese – Indice completo

PianetaChimica home

 

Dr.ssa LORETTA BOLGAN – PCR – ESOSOMI – INTERFERONE BETA

 

<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<